View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3175_low_51 (Length: 237)
Name: NF3175_low_51
Description: NF3175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3175_low_51 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 35 - 222
Target Start/End: Original strand, 7724269 - 7724456
Alignment:
| Q |
35 |
acaaagacttgcatatacactatctcaattgcaagtctatagtgtgcatgaaatactatacatatttgttgtttttatttatatatatttttgctgaatt |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7724269 |
acaaagacttgcatatacactatctcaattgcaagtctatagtgtgcatgaaatactatacatatttgttgtttttatttatatatatttttgctgaatt |
7724368 |
T |
 |
| Q |
135 |
ccataccacacacgttcatatacacgaatactgataggtatgtacagtactgatggtggattggatttaattggtttgaagcaaatct |
222 |
Q |
| |
|
||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7724369 |
ccacaccacacacgttcatatacacgaatacagataggtatgtacagtactgatggtggattggatttaattggtttgaagcaaatct |
7724456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University