View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3175_low_52 (Length: 236)
Name: NF3175_low_52
Description: NF3175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3175_low_52 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 22310132 - 22310354
Alignment:
| Q |
1 |
tttacttgacctaataagcttttagaataagtatgattagtctttgcacacatattcacatgtgtgtgatgtactctaatggttaaggcgcgtgcctttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22310132 |
tttacttgacctaataagcttttagaataagtatgattagtctttacacacatattcacatgtgtgtgatgtactctaatggttaaggcgcgtgtctttg |
22310231 |
T |
 |
| Q |
101 |
aggcttttatcttgggttcgatcctgaaaataaatacatacaccctaaac-aaatgactcacttataaaaataattcgggctctgcgactgagtctaaat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| | ||||||| ||||||||| ||||| ||||||||||| |||| || |||||||||| || |
|
|
| T |
22310232 |
aggcttttatcttgggttcgatcctgaaaacaaatacatatatcctaaactaaatgactcgcttattaaaataattcgagctccgccactgagtctagat |
22310331 |
T |
 |
| Q |
200 |
taatttaatcatgaattgtatct |
222 |
Q |
| |
|
||||||| ||||||||||||||| |
|
|
| T |
22310332 |
taatttagtcatgaattgtatct |
22310354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University