View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3175_low_55 (Length: 235)
Name: NF3175_low_55
Description: NF3175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3175_low_55 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 158 - 235
Target Start/End: Complemental strand, 54840960 - 54840883
Alignment:
| Q |
158 |
gtcgacgtagactagtttcaaactcgtgacccagacatttggtgtatagtggattcacataggtaaccaacttttatt |
235 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
54840960 |
gtcgacgtggactagtttcaaactcatgacccagacatttggtgtatagtggattcaaataggtaaccaacttttatt |
54840883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 18 - 81
Target Start/End: Complemental strand, 54841097 - 54841034
Alignment:
| Q |
18 |
attttggtgtgaaaggtttatccttcaaactaaagaacttggattcaaatatgctcgaagatag |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54841097 |
attttggtgtgaaaggtttatccttcaaactaaagaacttggattcaaatatgctcgaagatag |
54841034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University