View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3175_low_56 (Length: 228)
Name: NF3175_low_56
Description: NF3175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3175_low_56 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 52792195 - 52792396
Alignment:
| Q |
1 |
tcaaaacagaagccctattatatcaacaaaaaagaaatagannnnnnnnccgtagccgggagt-gaacccggtatctaattcacttctacaagtgacaaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
52792195 |
tcaaaacagaagccctattatatcaacaaaaaagaaat-----------ccgtagc-gggagtcgaacccggtatctaattcacttctacaagtgacaaa |
52792282 |
T |
|
| Q |
100 |
aacatccgccgtgctactacagaattcttgatgtttgctgcgcaaattacattatttattctgtaacctgaattttaccccatatatatagacactaatt |
199 |
Q |
| |
|
||||||| ||||||||||||||||||| |||| ||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
52792283 |
aacatccaccgtgctactacagaattcgtgatatttgctg-gcaaattacattatttattctgtaacctgaa-tttaccccatatatatagacactaatt |
52792380 |
T |
|
| Q |
200 |
tttctttttgacagta |
215 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
52792381 |
tttctttttgacagta |
52792396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University