View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3176_high_13 (Length: 460)
Name: NF3176_high_13
Description: NF3176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3176_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 3e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 3e-80
Query Start/End: Original strand, 52 - 244
Target Start/End: Original strand, 16909921 - 16910113
Alignment:
| Q |
52 |
tctttctctatttctagtgatttgattctctttatttgatctacccatcttattactgaatccacatatannnnnnnacatgtccaaatcactcaaatct |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| ||| |
|
|
| T |
16909921 |
tctttctctatttctagtgatttgattctctttatttgatctacccatcttattactgaatccacatatatttttttacatgtccaaaccactcaagtct |
16910020 |
T |
 |
| Q |
152 |
aatttttgtattttattattgcaaataaaatatggaattttgttttggatttcacttgtacaaaggtcgtcttttggtatctcacttatacct |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
16910021 |
aatttttgtattttattattgcaaataaaatatggaattttgttttggatttcactttcacaaaggtcgtcttttggcatctcacttatacct |
16910113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 293 - 447
Target Start/End: Original strand, 16910154 - 16910306
Alignment:
| Q |
293 |
atatatatttaaatttcttaggttgggtgtgacactgaaagaaaaggaagattagggatagtcgaagcaaaggatgaagagtaaaagagatgaaaaagaa |
392 |
Q |
| |
|
|||||||| || |||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16910154 |
atatatatatatatttcttaggttgggtgtaaag--gaaagaaaaggaagattagggatagtcgaagcaaaggatgaagagtaaaagagataaaaaagaa |
16910251 |
T |
 |
| Q |
393 |
atagaaaaagaccggcttagtgacttgtgtgattctgttttgctcaatatgatga |
447 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16910252 |
agagaaaaagaccggcttagtgacttgtgtgattctgttttgctcaatataatga |
16910306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University