View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3176_high_39 (Length: 242)
Name: NF3176_high_39
Description: NF3176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3176_high_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 4 - 223
Target Start/End: Original strand, 38777049 - 38777268
Alignment:
| Q |
4 |
ccacaacaatttgatggaaaacaccctagggttgctccggcttcagcacttagcagcatgccattcacgacaacctattgaaatgtaaaaaatgtgattt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38777049 |
ccacaacaatttgatggaaaacaccctagggttgctccggcttcagcacttagcagcatgccattcacgaaaacctattgaaatgtaaaaaatgtgattt |
38777148 |
T |
 |
| Q |
104 |
ttgataagtttttgtactctttttctgtctttcttaacaaatgtcttgtagacactagttagcataaccttaaaagttttatctcgctagtactatgaag |
203 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
38777149 |
ttgataagtttttgtactctttttctgtttttcttaacaaatgtcttgtagacactagttagcataaccttaaaagttttatcttgatagtactatgaag |
38777248 |
T |
 |
| Q |
204 |
atttcttggtgcctgtatac |
223 |
Q |
| |
|
||||||| ||||||||||| |
|
|
| T |
38777249 |
atttctttctgcctgtatac |
38777268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University