View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3176_low_36 (Length: 262)
Name: NF3176_low_36
Description: NF3176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3176_low_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 16 - 255
Target Start/End: Complemental strand, 384648 - 384409
Alignment:
| Q |
16 |
ctttttagggattttgctaaccctaatgtgtcttttcctcttgttatcagagctcgtatttttgttacggttagttcttcataactcctcaattannnnn |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
384648 |
ctttttagggattttgctaaccctaatgtgtcttttcctcttgttatcagagctcgtatttttgttacagttagttcttcataactcctcaactattttt |
384549 |
T |
 |
| Q |
116 |
nnactttgttgttgttgttgatgtttatattcaaattatcattaggtagttgtgaatcgtgtcgggttggagatcattagtcagaatgttggaggtgact |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
384548 |
ttactttgttgttgttgttgatgtttatattcaaattatcattaggtagttgtgaatcgtgtcggattggagatcattagtcggaatgttggaggtgact |
384449 |
T |
 |
| Q |
216 |
tcgaaccgttgttcctatgatcaatagcttccttcatctc |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
384448 |
tcgaaccgttgttcctatgatcaatagcttccttcttctc |
384409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 16 - 94
Target Start/End: Complemental strand, 390025 - 389947
Alignment:
| Q |
16 |
ctttttagggattttgctaaccctaatgtgtcttttcctcttgttatcagagctcgtatttttgttacggttagttctt |
94 |
Q |
| |
|
||||||| |||||||| |||||||||| ||| ||||||||||||| ||||||||| |||| ||||||||||||||| |
|
|
| T |
390025 |
ctttttaaggattttgttaaccctaatacttctcttcctcttgttattagagctcgtgttttcattacggttagttctt |
389947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 121 - 170
Target Start/End: Complemental strand, 389908 - 389857
Alignment:
| Q |
121 |
ttgttgttgttgttgatgtttatattcaaatt--atcattaggtagttgtga |
170 |
Q |
| |
|
||||||||||||||| ||||||| |||||||| ||||||||||||| |||| |
|
|
| T |
389908 |
ttgttgttgttgttgttgtttatgttcaaattaaatcattaggtagtcgtga |
389857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University