View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3176_low_41 (Length: 250)
Name: NF3176_low_41
Description: NF3176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3176_low_41 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 18 - 218
Target Start/End: Original strand, 3524415 - 3524618
Alignment:
| Q |
18 |
cctctttggtacataatactatgtttactcttcaaaagcaaccaaagatccgannnnnnn-caaacctaagacctcctctttagtaagaccctcttattc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3524415 |
cctctttggtacataatactatgtttactcttcaaaagcaaccaaagatccgattttttttcaaacctaagacctcctctttagtaagaccctcttattc |
3524514 |
T |
|
| Q |
117 |
atat--ttgaagtctagagttgctatatacgtcaagcccattgattttctcctccaaatccccatacacttttcagttccacttcttgatttcacccttt |
214 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3524515 |
atatatttgaagtctagagttgctatatacgtcaagcccattgattttctcctccaaatccccatacacttttcagttccacttcttgatttcacccttt |
3524614 |
T |
|
| Q |
215 |
atca |
218 |
Q |
| |
|
|||| |
|
|
| T |
3524615 |
atca |
3524618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University