View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3176_low_44 (Length: 237)
Name: NF3176_low_44
Description: NF3176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3176_low_44 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 84; Significance: 5e-40; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 9786155 - 9786266
Alignment:
| Q |
1 |
tataatttttcttagttctaaaattttgtatgcttattattgcgatgcttaaatagagttgcttcattttctctaaacaattaatagtgtgttattttaa |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||||| || || ||||||||||||| |
|
|
| T |
9786155 |
tataatttttcttacttctaaaattttgtatgcttattattgtgatgctttaatagagttgcttcattttttctaaacaactagtattgtgttattttaa |
9786254 |
T |
|
| Q |
101 |
tagtcaagattt |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
9786255 |
tagtcaagattt |
9786266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 129 - 188
Target Start/End: Original strand, 9786255 - 9786314
Alignment:
| Q |
129 |
tagtcaagatttacaacctagacctatttatacagtgtttcttaaatattactccctccg |
188 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9786255 |
tagtcaagatttgtaacctagacctatttatacagtgtttcttaaatattactcgctccg |
9786314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 222
Target Start/End: Original strand, 32564829 - 32564873
Alignment:
| Q |
178 |
tactccctccgatcctatatgcaagcactctttacctctaataaa |
222 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||| |
|
|
| T |
32564829 |
tactccctccgtccctatatgtaagcactctttgcctctaataaa |
32564873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University