View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3176_low_46 (Length: 235)
Name: NF3176_low_46
Description: NF3176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3176_low_46 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 16470803 - 16470585
Alignment:
| Q |
1 |
tacagaacgaaaataaattaatttgcatgaagtttggttctactattcaatgaaaagaaataaacaaacttctaaaatgcgtggatctcaggtgaccttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
16470803 |
tacagaacgaaaataaattaatttgcatgatgtttgattctactattcaataaaaagaaataaacaaacttctaaaatgcgtggatctcaagtgtccttt |
16470704 |
T |
|
| Q |
101 |
aaccatcttaaaaatttctcttgcaagtttcttcatctattcgagtcttgggtgttgaagttctcttaaatctattgatatgacagctttgggaagttag |
200 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16470703 |
aaccatcttgaaaatttctcttgcaagtctcttcatctattcgagtcttgggtgttgaagttctcttaaatctattgatatgacagctttgggaagttag |
16470604 |
T |
|
| Q |
201 |
agacttttaaccttgaatg |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
16470603 |
agacttttaaccttgaatg |
16470585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University