View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3176_low_47 (Length: 234)
Name: NF3176_low_47
Description: NF3176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3176_low_47 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 20 - 222
Target Start/End: Original strand, 43212634 - 43212836
Alignment:
| Q |
20 |
atcagttacaaacaaattcctaatatgagttggacatgatccataaaacatcacagggttattcaaagagcatcctaaatttgcaagcgcatcaaagcat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43212634 |
atcagttacaaacaaattcctaatatgagttggatatgatccatagaacatcacagggttattcaaagagcatcctaaatttgcaagcgcatcaaagcat |
43212733 |
T |
|
| Q |
120 |
tgatttacctcttggtatgaatgagcgactttcacttcccattcattgaattgattaatgtagacactaaattgattgacggtatttaatttcagtataa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43212734 |
tgatttacctcttggtatgaatgagcgaccttcacttcccattcattgaattgattaatgtagacactaaattgattgacggtatttaatttcagtataa |
43212833 |
T |
|
| Q |
220 |
tct |
222 |
Q |
| |
|
||| |
|
|
| T |
43212834 |
tct |
43212836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University