View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3177-Insertion-17 (Length: 179)
Name: NF3177-Insertion-17
Description: NF3177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3177-Insertion-17 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 8 - 179
Target Start/End: Original strand, 776599 - 776766
Alignment:
| Q |
8 |
actagttgtttcaaacattaacttgtattagagaaactcatatcaagattaagtcaaaagttcaaagcacacaaaaacaacacggtgcatctggaattcc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
776599 |
actagttgtttcaaacattaacttgtattagagaaactcatatcaagattaagtcaaaagttcaaagcacacaaaaacaacacggtg----tggaattcc |
776694 |
T |
 |
| Q |
108 |
tcaatgaattcaatataattagatcctgataacattgaaaatccgaacaatgcaactttcaagaatgccata |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
776695 |
tcaatgaattcaatataattagatcctgataacattgaaaatccgaacaatacaactttcaagaatgccata |
776766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University