View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3177-Insertion-19 (Length: 88)
Name: NF3177-Insertion-19
Description: NF3177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3177-Insertion-19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 71; Significance: 9e-33; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 71; E-Value: 9e-33
Query Start/End: Original strand, 8 - 86
Target Start/End: Complemental strand, 33959702 - 33959624
Alignment:
| Q |
8 |
aaatatttctgcctgatcccacaaaaaccggcacataccaccgccatggctaaccaaaatttatatttgtcttcatcat |
86 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33959702 |
aaatatttcttcctgatcccacaaaaaccggcacatacaaccgccatggctaaccaaaatttatatttgtcttcatcat |
33959624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University