View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3177-Insertion-6 (Length: 559)
Name: NF3177-Insertion-6
Description: NF3177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3177-Insertion-6 |
 | |
|
| [»] chr7 (3 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 5e-51; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 445 - 559
Target Start/End: Complemental strand, 22046090 - 22045976
Alignment:
| Q |
445 |
catgagtgaaaaatctcaccctccacagccattgtcgcatttggaggcacttccacaaccacagtttccaccacagcaagacattttcagatgatgatga |
544 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22046090 |
catgagtgaaaaatctcaccctccacagccattgccgcatttgcaggcacttccacagccacagtttccaccacagcaagacattttcagatgatgatga |
22045991 |
T |
|
| Q |
545 |
tatcaaacacaaaca |
559 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
22045990 |
tatcaaacacaaaca |
22045976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 94 - 154
Target Start/End: Complemental strand, 22046467 - 22046407
Alignment:
| Q |
94 |
tgatcagatcagaattttaccaacatgagagaaagtgttaaaacacaatttgttttccatg |
154 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22046467 |
tgatcagatcacaattttaccaacatgagagaaagtgttaaaacacaatttgttttccatg |
22046407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 282 - 371
Target Start/End: Complemental strand, 22046258 - 22046167
Alignment:
| Q |
282 |
tagtggacggtggaattgatctcttcaatatctgattgatcacataccgagtttt--nnnnnnnntgtgtgatcacaatctccctcacccac |
371 |
Q |
| |
|
||||||||||| ||||||||||| || ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22046258 |
tagtggacggtagaattgatctcctcggtatctgattgatcacataccgagttttaaaaaaaaaatgtgtgatcacaatctccctcacccac |
22046167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University