View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3177_high_13 (Length: 238)
Name: NF3177_high_13
Description: NF3177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3177_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 18987771 - 18987978
Alignment:
| Q |
1 |
aaagtatttacctcataaagggaaaaattaagaaaaagaaattatgtgagattttatgcaaatgatgtggttgaaaaa--tggtatttgattattttgtt |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| ||| |
|
|
| T |
18987771 |
aaagtatttacctcataaagggaaaaattaagaaaaagaaattatgtgagattttatgcaaatgatgtggttgaaaaaaatgatatttgattatttagtt |
18987870 |
T |
|
| Q |
99 |
tagnnnnnnnngataagatttagtttcggtttttagtccgatataaaaatttataatttatttagtaataattttaatattaatggtcgaagattgtggt |
198 |
Q |
| |
|
||| |||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18987871 |
tagaaaa-----ataagatttagtttgggtttttcatccgatataaaaatttataatttatttagtaataattttaatattaatggtcgaagattgtggt |
18987965 |
T |
|
| Q |
199 |
tgtttgtaggagg |
211 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
18987966 |
tgtttgtcggagg |
18987978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 183
Target Start/End: Complemental strand, 41705795 - 41705761
Alignment:
| Q |
149 |
ttataatttatttagtaataattttaatattaatg |
183 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41705795 |
ttataatttatttagtaataattttaataataatg |
41705761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University