View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3177_low_12 (Length: 249)
Name: NF3177_low_12
Description: NF3177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3177_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 169 - 245
Target Start/End: Original strand, 51944254 - 51944329
Alignment:
| Q |
169 |
aaatatcatgtgacatttgtcaatcacaataatataaatgtataaaaagacaaaaaattatagttttcttctctctc |
245 |
Q |
| |
|
|||||| |||||| ||||||||||||||||| || |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
51944254 |
aaatattatgtgatatttgtcaatcacaatattacaaatgtataaaa-gacaaaaaattatagttttcttctctctc |
51944329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 207 - 245
Target Start/End: Original strand, 5036379 - 5036417
Alignment:
| Q |
207 |
tgtataaaaagacaaaaaattatagttttcttctctctc |
245 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5036379 |
tgtataaaaagacaaaaaatcatagttttcttctctctc |
5036417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 179 - 243
Target Start/End: Original strand, 42866503 - 42866566
Alignment:
| Q |
179 |
tgacatttgtcaatcacaataatataaatgtataaaaagacaaaaaattatagttttcttctctc |
243 |
Q |
| |
|
||||||| |||||| |||||| | ||||||| |||||||||||||| ||| ||||||||||||| |
|
|
| T |
42866503 |
tgacattggtcaattacaatatcacaaatgtacaaaaagacaaaaaa-tatggttttcttctctc |
42866566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University