View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3177_low_13 (Length: 239)
Name: NF3177_low_13
Description: NF3177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3177_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 232
Target Start/End: Original strand, 51943829 - 51944041
Alignment:
| Q |
18 |
accttctaaataggtaaagatcactacttaccagtgacgaatctacttaggcgtgagatctatcaccgtttggaagctaacatcaatatatcgatgttgg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
51943829 |
accttctaaataggtaaagatcactacttaccagtgacgaatctacttaggcgtgagatctattaccgtttggaagctaacatcaatatatcgatgttgg |
51943928 |
T |
|
| Q |
118 |
atgaagatttaaagtaatgccgatggaaattctagagcagtagtaacttcaaagacaaaataggaaaatacatgcatatgattttcttttgacaaaaata |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
51943929 |
atgaagatttaaagtaatgccgatggaaattctagagcagtagtaacttcaaagacaaaataggaaaatacatgcatatgattttcttttgacaaaa--a |
51944026 |
T |
|
| Q |
218 |
atgcatgcatatgat |
232 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
51944027 |
atacatgcatatgat |
51944041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University