View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3177_low_14 (Length: 238)

Name: NF3177_low_14
Description: NF3177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3177_low_14
NF3177_low_14
[»] chr5 (1 HSPs)
chr5 (1-211)||(18987771-18987978)
[»] chr8 (1 HSPs)
chr8 (149-183)||(41705761-41705795)


Alignment Details
Target: chr5 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 18987771 - 18987978
Alignment:
1 aaagtatttacctcataaagggaaaaattaagaaaaagaaattatgtgagattttatgcaaatgatgtggttgaaaaa--tggtatttgattattttgtt 98  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  || ||||||||||||| |||    
18987771 aaagtatttacctcataaagggaaaaattaagaaaaagaaattatgtgagattttatgcaaatgatgtggttgaaaaaaatgatatttgattatttagtt 18987870  T
99 tagnnnnnnnngataagatttagtttcggtttttagtccgatataaaaatttataatttatttagtaataattttaatattaatggtcgaagattgtggt 198  Q
    |||         |||||||||||||| |||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18987871 tagaaaa-----ataagatttagtttgggtttttcatccgatataaaaatttataatttatttagtaataattttaatattaatggtcgaagattgtggt 18987965  T
199 tgtttgtaggagg 211  Q
    ||||||| |||||    
18987966 tgtttgtcggagg 18987978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 183
Target Start/End: Complemental strand, 41705795 - 41705761
Alignment:
149 ttataatttatttagtaataattttaatattaatg 183  Q
    ||||||||||||||||||||||||||||| |||||    
41705795 ttataatttatttagtaataattttaataataatg 41705761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University