View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3177_low_3 (Length: 407)
Name: NF3177_low_3
Description: NF3177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3177_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 1e-60; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 58 - 230
Target Start/End: Complemental strand, 18987543 - 18987367
Alignment:
| Q |
58 |
ttttcacattacacttatgctcacaaaaacgtcattttcgttgagaacctcttttt-tcggggtcaactgtctgtccctgtcgtgaaacaaaaacggtca |
156 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18987543 |
ttttcacagtacacttacgctcacaaaaacgtcattttcgttgagaacctctttttgtcggggtcaactgtctgtccctgtcgtgaaacaaaaagggtca |
18987444 |
T |
 |
| Q |
157 |
atggaatctctattgcatcaacatca---tcatgccctctttagttcagtcccaaccaaccccacttggcttgttcc |
230 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||| |||||||||| |||||||| ||||||| || |||||| |
|
|
| T |
18987443 |
atggaatctctattgcatcaacatcatcatcatgcactcattagttcagtaccaaccaaacccacttcgcatgttcc |
18987367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 329 - 388
Target Start/End: Complemental strand, 18987268 - 18987209
Alignment:
| Q |
329 |
ggtacaccaccttttattgcttttgataacaacccttttatttctattctttattttatg |
388 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||| ||||||||||| |||| |
|
|
| T |
18987268 |
ggtacaccatcttttattgcttttgataacaaccctttcatttttattctttattatatg |
18987209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University