View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3177_low_4 (Length: 385)
Name: NF3177_low_4
Description: NF3177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3177_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 353; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 353; E-Value: 0
Query Start/End: Original strand, 1 - 369
Target Start/End: Complemental strand, 37405945 - 37405577
Alignment:
| Q |
1 |
atattacctagaatgcaacaacaaccactgcagggtgcttttgtttctccacgttggtgatgagaactgcaaatgtttctgcaagcattgcaaacatgca |
100 |
Q |
| |
|
||||||| ||||| |||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37405945 |
atattacatagaaagcaacaacaacctctgcagggtgcttttgtttctccactttggtgatgagaactgcaaatgtttctgcaagcattgcaaacatgca |
37405846 |
T |
 |
| Q |
101 |
cagtagtgtttgtaggagataaatcaccctttttgtatcttctgtatttggatgtaacttccattgtttgcagtgtgagcccagatagcatgcatgcagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37405845 |
cagtagtgtttgtaggagataaatcaccctttttgtatcttctgtatttggatgtaacttccattgtttgcagtgtgagcccagatagcatgcatgcagc |
37405746 |
T |
 |
| Q |
201 |
atcaagatatttataatgcagatttgtaggcacaaagacacactgaaatgtatgttagaatttgttttgggactaatttcaaatttgtgttgtacactta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37405745 |
atcaagatatttataatgcagatttgtaggcacaaagacacactgaaatgtatgttagaatttgttttgggactaatttcaaatttgtgttgtacactta |
37405646 |
T |
 |
| Q |
301 |
tatgaacatattttcaagtcacttttcatattatgtggactctcaacattcccttggctcttaggattg |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37405645 |
tatgaacatattttcaagtcacttttcatattatgtggactctcaacattcccttggctcttaggattg |
37405577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University