View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3178_high_10 (Length: 253)
Name: NF3178_high_10
Description: NF3178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3178_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 43 - 245
Target Start/End: Complemental strand, 26211394 - 26211192
Alignment:
| Q |
43 |
tggagatattgtcacaaatgtggtcattgttagggttactaacagttctccaaaacgtacttccaacacagcttctctcagtgcttcattcactgtacga |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26211394 |
tggagatattgtcacaaatgtggtcattgttagggttactaacagttctccaaaacgtacttccaacacagcttctctcagtgcttcattcactgtacga |
26211295 |
T |
 |
| Q |
143 |
atcacttcaagatcttctttctccatactcatactttgaaattcccgaattcaatggttactgcggcgtcgaactcaacgacctctaccgccacgttcat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
26211294 |
atcacttcaagatcttctttctccatactcatactttgaaattcccgaattcaacggttactgcggcgtcgaactcaacgacctctaccgccacgtccat |
26211195 |
T |
 |
| Q |
243 |
ctc |
245 |
Q |
| |
|
||| |
|
|
| T |
26211194 |
ctc |
26211192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University