View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3178_low_17 (Length: 242)
Name: NF3178_low_17
Description: NF3178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3178_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 19 - 225
Target Start/End: Original strand, 47884432 - 47884639
Alignment:
| Q |
19 |
gtaaggcaatctagtatatctggaaacccttcacttgatttgaatcatcgtgtttcaaatcttagatttaagggaaaacaacatgtggttaaggttagag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47884432 |
gtaaggcaatctagtatatctggaaacccttcacttgatttgaatcatcgtgtttcaaatcttagatttaagggaaaacaacatgttgttaaggttagag |
47884531 |
T |
 |
| Q |
119 |
caacagtggaagtgggtggtgtggaggattt-nnnnnnngaagaagcaatgttgcattggagggaaatttaggtttggatatggtttcagaaggagagtt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47884532 |
caacagtggaagtgggtggtgtggaggatttaaaaaaaagaagaagcaatgttgcattggagggaaatttgggtttggatatggtttcagaaggagagtt |
47884631 |
T |
 |
| Q |
218 |
aatggtga |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
47884632 |
aatggtga |
47884639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 158 - 225
Target Start/End: Original strand, 47880758 - 47880822
Alignment:
| Q |
158 |
aagaagcaatgttgcattggagggaaatttaggtttggatatggtttcagaaggagagttaatggtga |
225 |
Q |
| |
|
||||||||||||||||||| |||||| ||| || |||||||||||||| ||||||||||||||||| |
|
|
| T |
47880758 |
aagaagcaatgttgcattgtagggaactttggggttggatatggtttc---aggagagttaatggtga |
47880822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University