View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3181_low_9 (Length: 347)
Name: NF3181_low_9
Description: NF3181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3181_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 11 - 331
Target Start/End: Original strand, 37128794 - 37129114
Alignment:
| Q |
11 |
catagggaggaaaaataggtttttcattatattattggttgtcaaacctatatatgcctgccaattcgtagaaggagccgaacgcaagtgaaattttcag |
110 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37128794 |
catagggaggcaaaataggtttttcattatattattggttgtcaaaccaatatatgcctgccaattcgtagaaggagccgaacgcaagtgaaattttcag |
37128893 |
T |
 |
| Q |
111 |
cccattatccttaggcaattgctttatcgactcttcatttttactcaaaagctctcaatttatcaaaatgtatctttcgatgacacagatctattggaat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
37128894 |
cccattatccttaggcaattgctttatcgactcttcatttttactcaaaagctctcaatttatcaaaatgtatctttcgataacacaaatctattggaat |
37128993 |
T |
 |
| Q |
211 |
ggagtattttcagattgacttatttttactatccatcaaaaactattttttgatcgacannnnnnnncagggttgagcgacctaagaacctaaagaacaa |
310 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37128994 |
ggagtattttcagattgatttatttttactatccatcaaaaactattttttgatcgacattttttttcagggttgagcgacctaagaacctaaagaacaa |
37129093 |
T |
 |
| Q |
311 |
ccttattatccttatcaattc |
331 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
37129094 |
ccttattatccttatcaattc |
37129114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University