View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3182_low_4 (Length: 326)
Name: NF3182_low_4
Description: NF3182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3182_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 268; Significance: 1e-149; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 17 - 316
Target Start/End: Original strand, 7000946 - 7001245
Alignment:
| Q |
17 |
aattttatcgtcacagaatttagtgaagaaatcattgagggatttcatgttttttctttctaaattccctcaccactttccctgagtttggtttccgagg |
116 |
Q |
| |
|
||||| || ||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
7000946 |
aatttcatagtcacagaatttagtgaagaaattattgaggtatttcatgttttttctttctaaattccctcaccactttccctgagtttggtttccaagg |
7001045 |
T |
 |
| Q |
117 |
ccggcgacaccatgggatgtttcagttctacctccgatgaaaaatgtgattgtcttcctttcttcacggtttgccgaggttacacctaaaaaatgcgact |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
7001046 |
ccggcgacaccatgggatgtttcagttctacctccgatgaaaaatgtgattgtcttcctttcttcacggtttgccgatgttacacctcaaaaatgcgact |
7001145 |
T |
 |
| Q |
217 |
ttctttaaccttccctcagaaacaagagtagctcaattctttcttttggtattggcactctaatacagtcagctggtttgtgtttctatgtttatctgtg |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7001146 |
ttctttaaccttccctcagaaacaagagtagctcaattctttcttttggtattggcactctaatacagtcagctggtttgtttttctatgtttatctgtg |
7001245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 10793425 - 10793347
Alignment:
| Q |
99 |
tgagtttggtttccgaggccggcgacaccatgggatgtttcagttctacctccgatgaaaaatgtgattgtcttccttt |
177 |
Q |
| |
|
||||||| |||||| ||||| || |||||| |||||||||||||||||||||||| | ||| | |||||||||||||| |
|
|
| T |
10793425 |
tgagtttcatttccggggccgacgccaccataggatgtttcagttctacctccgatcagaaacgcgattgtcttccttt |
10793347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 256 - 288
Target Start/End: Complemental strand, 10793222 - 10793190
Alignment:
| Q |
256 |
tttcttttggtattggcactctaatacagtcag |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
10793222 |
tttcttttggtattggcactctaatacagtcag |
10793190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 7834782 - 7834704
Alignment:
| Q |
99 |
tgagtttggtttccgaggccggcgacaccatgggatgtttcagttctacctccgatgaaaaatgtgattgtcttccttt |
177 |
Q |
| |
|
||||||| |||||| ||||| || ||||||||||||||||||||||||||||||| | ||| | |||||||||||||| |
|
|
| T |
7834782 |
tgagtttcatttccggggccgacgccaccatgggatgtttcagttctacctccgatcagaaacgcgattgtcttccttt |
7834704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 256 - 288
Target Start/End: Complemental strand, 7834579 - 7834547
Alignment:
| Q |
256 |
tttcttttggtattggcactctaatacagtcag |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
7834579 |
tttcttttggtattggcactctaatacagtcag |
7834547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 99 - 177
Target Start/End: Original strand, 34268198 - 34268276
Alignment:
| Q |
99 |
tgagtttggtttccgaggccggcgacaccatgggatgtttcagttctacctccgatgaaaaatgtgattgtcttccttt |
177 |
Q |
| |
|
||||||| |||||| ||||| || |||||| |||||||||||||||||||||||| | ||| | |||||||||||||| |
|
|
| T |
34268198 |
tgagtttcatttccggggccgacgccaccataggatgtttcagttctacctccgatcagaaacgcgattgtcttccttt |
34268276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 256 - 288
Target Start/End: Original strand, 34268413 - 34268445
Alignment:
| Q |
256 |
tttcttttggtattggcactctaatacagtcag |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34268413 |
tttcttttggtattggcactctaatacagtcag |
34268445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University