View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3182_low_8 (Length: 205)
Name: NF3182_low_8
Description: NF3182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3182_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 19 - 185
Target Start/End: Complemental strand, 44449571 - 44449401
Alignment:
| Q |
19 |
ctaattaatcaatccctatcaattggtaacgtgagactctcaaccggcctctatagtgtgggggttcttctatgtctaagcttcatgttggtttcaactt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44449571 |
ctaattaatcaatccctatcaattggtaacgtgagactctcaactggcctctatagtgtgggggttcttctatgtctaagcttcatgttgctttcaactt |
44449472 |
T |
|
| Q |
119 |
ttttcattaatggtat----atccatcccttatccacgggatgcttattagttgcacgacacatgtccaca |
185 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44449471 |
ttttcattaatggtatatcgatccatcccttatccacgggatgcttattagttgcacgacacatgtccaca |
44449401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University