View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3183_high_5 (Length: 283)
Name: NF3183_high_5
Description: NF3183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3183_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 82 - 267
Target Start/End: Complemental strand, 48175351 - 48175165
Alignment:
| Q |
82 |
agtgcttcaagattttggcttatatagagaaattggaggtaaatggacnnnnnnnnnnnnn-gtccgtatatgaatgatgacatatgagaattagatacc |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48175351 |
agtgcttcaagattttggcttatatagagaaattggaggtaaatggactttttttttttgttgtccgtatatgaatgatgacatatgagaattagatacc |
48175252 |
T |
 |
| Q |
181 |
tttatacccaatccaatccattttcctagtttattccaattatcataatcaaatcaataatatggcattcatgggaagacaataaat |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48175251 |
tttatacccaatccaatccattttcctagtttattccaattattataatcaaatcaataatatggcattcatgggaagacaaaaaat |
48175165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 12 - 70
Target Start/End: Complemental strand, 48175474 - 48175416
Alignment:
| Q |
12 |
agagacactaattggaattggaaacaaccattccaaatccatcaacaccattgcaaatt |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48175474 |
agagacactaattggaattggaaacaaccattccaaatccatgaacaccattgcaaatt |
48175416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University