View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3183_high_9 (Length: 226)
Name: NF3183_high_9
Description: NF3183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3183_high_9 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 3 - 226
Target Start/End: Original strand, 30668428 - 30668651
Alignment:
| Q |
3 |
gagaaagggaaacccctggttccagttttttgcttcggacaggtatttatttgttacataggtctcttttactcatatctcaatgtttctannnnnnnca |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |||||||||||| || |
|
|
| T |
30668428 |
gagaaagggaaacccctggttccagttttttgcttcggacaggtatttatttgttacataggtctcctctactcatatgtcaatgtttctatttttttca |
30668527 |
T |
 |
| Q |
103 |
ttacatttgttcattcaaattaacattcatcttcaaatgcaatgtcgctatagtcagatgtctataagtggtggaaaccaggtgggaagctaattctgaa |
202 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30668528 |
ttacatttgttcagtcaaattaacattcatcttcaaatgcaatgtcgctatagtcagatgtctataagtggtggaaaccaggtgggaagctaattctgaa |
30668627 |
T |
 |
| Q |
203 |
tatcgcaagggctatcaagttcat |
226 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
30668628 |
tatcgcaagggctatcaagttcat |
30668651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University