View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3183_low_10 (Length: 239)

Name: NF3183_low_10
Description: NF3183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3183_low_10
NF3183_low_10
[»] chr2 (1 HSPs)
chr2 (18-239)||(41942773-41942997)


Alignment Details
Target: chr2 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 41942997 - 41942773
Alignment:
18 gttttcaacacccccatttttactgttatgttaaatctgaacaaatgtactactggtgataataaagtaaaaaa----taaatggagtacatagatagaa 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||||||||||||    
41942997 gttttcaacacccccatttttactgttatgttaaatctgaacaaatgtactactggtgataataaagtaaaaaaaaaataaatggagtacatagatagaa 41942898  T
114 accctggtaacagtgatagagcctgcagaaaaagatggaaagagaatttacctaagaagagaagagagggcnnnnnnnnnntggagacagagaacgtgga 213  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||    
41942897 accctggtaacagtgatagagcctgcagaaaaagatggaaagagaatttacctaagaagagaagagagggc-aaaaaaaaatggagacagagaacgtgga 41942799  T
214 gtcccgtttttgttggttgggctgat 239  Q
    ||||||||||||||||||||||||||    
41942798 gtcccgtttttgttggttgggctgat 41942773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University