View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3184_high_42 (Length: 321)
Name: NF3184_high_42
Description: NF3184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3184_high_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 304
Target Start/End: Original strand, 42686951 - 42687260
Alignment:
| Q |
1 |
ttagtcgaaagagttttgtttggagtttctcacgaacaatgtgacaaccgatttcaatatgctcaataggctcgtgaaaggttgaatttgcagcaatatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42686951 |
ttagtcgaaagagttttgtttggagtttctcgcgaacattgtgacaaccgatttcaatatgctcaataggctcgtgaaaggttgaatttgcagcaatatg |
42687050 |
T |
 |
| Q |
101 |
acaggtgaatttgccgtcacagtacagaaaagctggagtaatggaagcaacctg------tctaagtaaataagtcagacactgtaacctagactggcag |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42687051 |
acaggtgaatttgccgtcacagtacagaaaagctggagtaatggaagcaacctgaagatctctaagtaaataagtcagacactgtaacctagactggcag |
42687150 |
T |
 |
| Q |
195 |
cgagagcacgttattcagcttctgttgagcaatgagatacaattgcttgcttctttgaacaccatgaaatgagtgtcacccaagaagacgcagtatcctg |
294 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42687151 |
cgagagcacgatattcagcttctgttgagcaatgagatacaattgcttgcttctttgaacaccatgaaatgagtgtcacccaagaagatgcagtatcctg |
42687250 |
T |
 |
| Q |
295 |
tgacagatct |
304 |
Q |
| |
|
|||||||||| |
|
|
| T |
42687251 |
tgacagatct |
42687260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University