View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3184_high_5 (Length: 602)
Name: NF3184_high_5
Description: NF3184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3184_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-115; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 10 - 319
Target Start/End: Original strand, 39413599 - 39413912
Alignment:
| Q |
10 |
catcatcagatacagtttcatacatctcatcgtcatcatgaatcacaagaggtgcttctgagctgctaccaggacctttgaaaatagttctcatcttgct |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39413599 |
catcatcagatacagtttcatacatctcatcatcatcatcaatcacaaatggtgcttctgagctgctaccaggacctttgacaatagttctcatcttgct |
39413698 |
T |
 |
| Q |
110 |
tttgcgtagtcttccacgcgttcttctttgaagtcccaaatgcttcacctttgttttgtttgatttctttgcagcaggggaaataggaggtctttctgta |
209 |
Q |
| |
|
| ||||||||||||||| ||||||||||| ||||||||||| |||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39413699 |
tgtgcgtagtcttccacttgttcttctttgtagtcccaaatgtttcacctttggtttgtttgatttctttgcagcaggggcaataggaggtctttctgta |
39413798 |
T |
 |
| Q |
210 |
acctttaccttctttttaacatgcccaggactagtaacaacaggagtgcc---aacaacaggaggcctttctgccattttcgc-nnnnnnnctgcaactg |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |||| |||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
39413799 |
acctttaccttctttttaacatgcccaggaccagtaacaacaggaatgccaagaacaacaggaggtctttctgccattttcgcaaaaaaaactgcaactg |
39413898 |
T |
 |
| Q |
306 |
agttctggtttgtt |
319 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
39413899 |
agttctggtttgtt |
39413912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 446 - 587
Target Start/End: Original strand, 39414038 - 39414181
Alignment:
| Q |
446 |
tacaggtgtgatgattttgggctgagtc--tattttttgatacatg-atgtgccgtgtcactgaaccaatgccaactcatggtcnnnnnnnatgacaatg |
542 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| || || || ||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
39414038 |
tacaggtgtgatgattttgggctgagtcaatatttttggacacgtggatgtgccgtgtcactgaaccaatgccaactcgtggtctttttcgatgacaatg |
39414137 |
T |
 |
| Q |
543 |
ttaacgagggactaaaatataaatgggttcaaatatcataggggt |
587 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
39414138 |
ttaatgagggact-aaatataaatgggttcaaatattataggggt |
39414181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 10 - 47
Target Start/End: Original strand, 39402532 - 39402569
Alignment:
| Q |
10 |
catcatcagatacagtttcatacatctcatcgtcatca |
47 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
39402532 |
catcatcagatacagttgcatacatctcatcatcatca |
39402569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University