View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3184_high_69 (Length: 234)
Name: NF3184_high_69
Description: NF3184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3184_high_69 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 35916397 - 35916549
Alignment:
| Q |
1 |
ttgcgggtttgcatctttgtgcaatgtaggggatgatcctgaattggtgaagaccaagttaagacattgggctcaagctgttgcatgttccgtgatgcag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916397 |
ttgcgggtttgcatctttgtgcaatgtaggggatgatcctgaattggtgaagaccaaattaagacattgggctcaagctgttgcatgttccgtgatgcag |
35916496 |
T |
 |
| Q |
101 |
tcttctggaagtggaagttgagctgtttcccacaaagggattgatgttgtttc |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916497 |
tcttctggaagtggaagttgagctgtttcccacaaagggattgatgttgtttc |
35916549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University