View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3184_low_49 (Length: 302)
Name: NF3184_low_49
Description: NF3184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3184_low_49 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 57 - 286
Target Start/End: Complemental strand, 40354877 - 40354647
Alignment:
| Q |
57 |
ttaaataaagtaaatgttaaaatgcgttactttgtcagcttatgacttattatggcaggcacagacatggagtcagtggtagggatgttgagtttaacac |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40354877 |
ttaaataaagtaaatgttaaaatgcgttactttgtcagcttatgacttattatggcaggcacagacatgtagtcagtggtagggatgttgagtttaacac |
40354778 |
T |
 |
| Q |
157 |
tgagagactgatcaaaccaagcagtgg-ttaatcaatgaatcaaattcaattttactgctgacaaattttttactaacataacatcatcaaatcccacct |
255 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40354777 |
tgagagactgatcaaaccaagcagtggtttaatcaatgaatcaaattcaattttactgctgacaaattttttactaacataacatcatcaaatcccacct |
40354678 |
T |
 |
| Q |
256 |
ttttattttcctttaacttgcaacattttct |
286 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |
|
|
| T |
40354677 |
ttttattttcctttaacttgcgacattttct |
40354647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 34 - 70
Target Start/End: Complemental strand, 17442855 - 17442819
Alignment:
| Q |
34 |
tggttgtacaaatattatttctcttaaataaagtaaa |
70 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
17442855 |
tggttgtacaaatattatttctcttaaaaaaattaaa |
17442819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University