View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3184_low_50 (Length: 298)
Name: NF3184_low_50
Description: NF3184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3184_low_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 280
Target Start/End: Original strand, 3247279 - 3247558
Alignment:
| Q |
1 |
gagagctgaacttctgcattttaacttccgaaaacacacgtgcactaagttcactgataatagcattgctggttgttttctattacttaatctcctcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3247279 |
gagagctgaacttctgcattttaacttccgaaaacacacgtgcactaagttcactgataatagcattgctggttgttttctattacttaatctcctcaaa |
3247378 |
T |
|
| Q |
101 |
gagtattttggcttcaaggcctctttacattgtcttggtaactgatgtcacgattgtcattgctcgcatttacagcgaaaaggctcgagttttggaagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3247379 |
gagtattttggcttcaaggcctctttacattgtcttggtaaccgatgtcacgattgtcattgctcgcatatacagcgaaaaggctcgagttttggaagaa |
3247478 |
T |
|
| Q |
201 |
aataaaggagaaatggttgaagctgctgaagatggacgcagttggaatgatgcagtgaaacttttggagagaggtttggt |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3247479 |
aataaaggagaaatggttgaagctgctgaagatggacgcagttggaatgatgcagtgaaacttttggagagaggtttggt |
3247558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University