View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3184_low_60 (Length: 256)
Name: NF3184_low_60
Description: NF3184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3184_low_60 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 246
Target Start/End: Complemental strand, 54617441 - 54617220
Alignment:
| Q |
18 |
attatcatgtctattataaatcaccttagaaatgttttaatgcttacaatatcccgatgtccatgcaaatctcttgcctgtgaattgttaaatttaagta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54617441 |
attatcatgtctattataaatcaccttagaaatgttttaatgcttacaatatcccgatgtccatgcaaatctcttgcctgtgaattgttaaatttaagta |
54617342 |
T |
|
| Q |
118 |
tctccttatgtcttatgttacactccctgtgttgctcatatttattaacaattttagttttttccccttcttctcatgatttcttaacttgatggccaat |
217 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
54617341 |
tctcctt-------atgttacgctccctgtgttgctcatatttattaacaattttagttttttccccttcttctcatgatttcttaacttgatggcctat |
54617249 |
T |
|
| Q |
218 |
attgactaaccgctttattctgacttctt |
246 |
Q |
| |
|
|||||||||||||| |||||||||||||| |
|
|
| T |
54617248 |
attgactaaccgctatattctgacttctt |
54617220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University