View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3184_low_67 (Length: 240)
Name: NF3184_low_67
Description: NF3184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3184_low_67 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 23 - 225
Target Start/End: Complemental strand, 5220297 - 5220094
Alignment:
| Q |
23 |
tattcaatattctaatttt-cgaattagataagatgattcgagtcttttctataaatattaacgtgaagttagtggttcaaatatagtcttgacttatct |
121 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5220297 |
tattcaatattctaatttttcgaattagataagatgattcgagtcttttctataaatattaacgtgaagttagtggttcgaatatagtcttgacttatct |
5220198 |
T |
 |
| Q |
122 |
cttttaatttaactaaatgattttagttcgaacgataaatcgaggctcgattctaattaaacattggattaattatagggaattggttagaatttagtat |
221 |
Q |
| |
|
|||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
5220197 |
cttttagtttaactaaacgattttagttcgaatgataaatcgaggctcgattctaattaaacattggattaattataggtaattagttagaatttagtat |
5220098 |
T |
 |
| Q |
222 |
taac |
225 |
Q |
| |
|
|||| |
|
|
| T |
5220097 |
taac |
5220094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University