View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3184_low_78 (Length: 222)
Name: NF3184_low_78
Description: NF3184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3184_low_78 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 24 - 205
Target Start/End: Complemental strand, 27808786 - 27808608
Alignment:
| Q |
24 |
aagttttgtccctaaaatattaccaaatttcattttatgtcgtttaaagtnnnnnnnnnttgatatgtttccgtccctacaaatatttcctgcacgcaac |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27808786 |
aagttttgtccctaaaatattaccaaatttcattttatgtcgtgtaaagtaaaaaaa---tgatatgtttccgtccctacaaatatttcctgcacgcaac |
27808690 |
T |
|
| Q |
124 |
cttatacctgatgaggtccagtatccctgccctactccatttctccatgacatgattggaaacgagttcagggtggatatta |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27808689 |
cttatacctgatgaggtccagtatccctgccctactccatttctccatgacatgattggaaacgagttcagggtggatatta |
27808608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University