View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3185_high_15 (Length: 296)
Name: NF3185_high_15
Description: NF3185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3185_high_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 268; Significance: 1e-149; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 17 - 284
Target Start/End: Original strand, 40451676 - 40451943
Alignment:
| Q |
17 |
cacaagtacctccactttgttgctaatatggatgttttgacagcatccttggtggagagaaatgaaagaatatggtgaagaatgttatcgggtaagtcac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40451676 |
cacaagtacctccactttgttgctaatatggatgttttgacagcatccttggtggagagaaatgaaagaatatggtgaagaatgttatcgggtaagtcac |
40451775 |
T |
|
| Q |
117 |
taatatttttctccattttgagtgatgatgattcattgatgagatttttcatcttttcgtgtaatgattcattgatgagatatgcttgattgcccaagaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40451776 |
taatatttttctccattttgagtgatgatgattcattgatgagatttttcatcttttcgtgtaatgattcattgatgagatatgcttgattgcccaagaa |
40451875 |
T |
|
| Q |
217 |
aaggtatggaagatggtggacatctttggacaccatgttgctgctcatctttctaggtctcatgttca |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40451876 |
aaggtatggaagatggtggacatctttggacaccatgttgctgctcatctttctaggtctcatgttca |
40451943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 261
Target Start/End: Complemental strand, 40275904 - 40275820
Alignment:
| Q |
180 |
atgattcattgatgagatatgcttgattgcccaagaaaaggtatgg---aagatggtggacatctttggacaccatgttgctgct |
261 |
Q |
| |
|
|||||||||||||||||||||||| | | ||||| | ||||||||| |||||| |||||||| |||||||||| | ||||||| |
|
|
| T |
40275904 |
atgattcattgatgagatatgctttactccccaaaacaaggtatggaagaagatgatggacatcattggacaccaagctgctgct |
40275820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University