View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3185_high_31 (Length: 236)
Name: NF3185_high_31
Description: NF3185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3185_high_31 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 21 - 236
Target Start/End: Complemental strand, 7181339 - 7181124
Alignment:
| Q |
21 |
tgcttttcccaaaattccattatccagtgccaaagaaaactcttttaacactaaacctgaagagaaatccaattctaagaatcaaagcttcaaaagatga |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7181339 |
tgcttttcccaaaattccattatccagtgccaaagaaaactcttttaacactaaacctgaagagaaatccaattctaagaatcaaagcttcaaaagatga |
7181240 |
T |
 |
| Q |
121 |
taatgggcaatcaccaaattggtctaagtggattcccaccggctcttttgctgctgacaaagttttcagattgatttcaagtgctactgctagtcccatt |
220 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7181239 |
taatggtcaatcaccaaattggtctaagtggattcccaccggctcttttgctgctgacaaagttttcagattgatttcaagtgctactgctagtcccatt |
7181140 |
T |
 |
| Q |
221 |
ggactgtttgtttctt |
236 |
Q |
| |
|
|||| ||||||||||| |
|
|
| T |
7181139 |
ggacagtttgtttctt |
7181124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University