View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3185_low_17 (Length: 316)
Name: NF3185_low_17
Description: NF3185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3185_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 80; Significance: 2e-37; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 68 - 151
Target Start/End: Original strand, 16140317 - 16140400
Alignment:
| Q |
68 |
taaatctacacaaactatgatttattttattgaatttcaaaaaacattgatacacattttgtaaagaaaaaacaatgatacaca |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16140317 |
taaatctacacaaactatgatttattttattgaatttcaaaaaacaatgatacacattttgtaaagaaaaaacaatgatacaca |
16140400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 21 - 70
Target Start/End: Original strand, 16140251 - 16140300
Alignment:
| Q |
21 |
tagatacaccagttattgaatagatttgaaaagtaaattgactcttataa |
70 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16140251 |
tagatacaccaattattgaatagatttgaaaactaaattgactcttataa |
16140300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University