View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3185_low_37 (Length: 228)
Name: NF3185_low_37
Description: NF3185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3185_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 14 - 114
Target Start/End: Complemental strand, 42230213 - 42230113
Alignment:
| Q |
14 |
gagatgaacagaaataagcaaattgcaaatacatgattaattgcagccattggtatacacaacgtaatgctacaaagtgacactcttcatacaacaaacc |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42230213 |
gagaagaacagaaataagcaaattgcaaatacatgattaattgcagccattggtatacacaatgtaatgctacaaagtgacactcttcatacaacaaacc |
42230114 |
T |
 |
| Q |
114 |
c |
114 |
Q |
| |
|
| |
|
|
| T |
42230113 |
c |
42230113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 142 - 213
Target Start/End: Complemental strand, 42230085 - 42230013
Alignment:
| Q |
142 |
caggaacatagtcccgtgtcccaaactaggagactacaatattatta-aaaacaagaaacaaagtgtagttat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42230085 |
caggaacatagtcccgtgtcccaaactaggaaactacaatattattaaaaaacaagaaacaaagtgtagttat |
42230013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University