View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3185_low_40 (Length: 226)
Name: NF3185_low_40
Description: NF3185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3185_low_40 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 7181117 - 7180999
Alignment:
| Q |
1 |
ccacttttcttcactctattgatccacgagttaaattggtaagcaaatttgtttcatgggttttgtattttactctgaatttgatgtaaaagaatgtgct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7181117 |
ccacttttcttcactctattgatccacgagttaaattggtaagcaaatttgtttcatgggttttgtagtttactctgaatttgatgtaaaagaatgtgct |
7181018 |
T |
|
| Q |
101 |
ttttattcatgcttgtgca |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
7181017 |
ttttattcatgcttgtgca |
7180999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 7180937 - 7180898
Alignment:
| Q |
181 |
ccgatgaacttgtgtcctatactttgatatatgttgcact |
220 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7180937 |
ccgatgaacctgtgtcctatactttgatatatgttgcact |
7180898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University