View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3190_high_58 (Length: 240)
Name: NF3190_high_58
Description: NF3190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3190_high_58 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 51846815 - 51847018
Alignment:
| Q |
18 |
ggtcacttacatagggagaaaaattggatgcatgcatggctttatggaactactcgaacttctataaaccaaaaaccaaaagatgctgaagattggagtg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51846815 |
ggtcacttacatagggagaaaaattggatgcatgcatggctttatggaactgctcgaacttctataaaccaaaaaccaaaagatgctgaagattggagtg |
51846914 |
T |
 |
| Q |
118 |
ttttccatgttttggctccttttttgagttgaaaaatgtgaaagtacaagatcaattgaatggtgtgcctcttgtgctgtttatggcccttgtaaattaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
51846915 |
ttttccatgttttggctccttttttgagttgaaaaatgtgaaagtacaagatcaattgaatggcgtgcctcttgtgctgtttatggcccttgtaaattaa |
51847014 |
T |
 |
| Q |
218 |
tgtg |
221 |
Q |
| |
|
|||| |
|
|
| T |
51847015 |
tgtg |
51847018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University