View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3190_high_59 (Length: 239)
Name: NF3190_high_59
Description: NF3190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3190_high_59 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 5 - 225
Target Start/End: Original strand, 116055 - 116275
Alignment:
| Q |
5 |
agcagcaacaacaaaagaatcatggtaggaatcgatctaaacaacgtcaagatcttgatgcatcaattgccaaattttctttgaagaataagggaagaag |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
116055 |
agcagcaacaacaaaagaatcatggtaggaatcgatctaaacaacgtcaagatcttgatgcatcaattgccaaattttctttgaagaataagggaagaag |
116154 |
T |
 |
| Q |
105 |
gatagatagtgtgatctgattgtgagattcatatattccaaatataaatagtatatctatttcacatagcagaactaatgtcccaagtatgtttggtgga |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
116155 |
gatagatagtgtgatctgattgtgagattcatatattccaaatataaatagtatatctatttcacatagcagaactaatgtcccaagtatgtttggtgga |
116254 |
T |
 |
| Q |
205 |
gtggatcttgtagaagaaagt |
225 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
116255 |
gtggatcttgtagaagaaagt |
116275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University