View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3190_high_74 (Length: 224)
Name: NF3190_high_74
Description: NF3190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3190_high_74 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 2 - 218
Target Start/End: Complemental strand, 24291104 - 24290887
Alignment:
| Q |
2 |
atcatatttctcctatcaatggagaaagaagagttgtcaaaaaattctcatttaggttcgatatcccagattctcaagcaagtgactgatcgtgtttatt |
101 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||| ||||||||| || |||||||||||| |||| ||||||||||||||| ||| ||| ||||||||| |
|
|
| T |
24291104 |
atcataattctcctatcaatagagaaagaagaattgtcaaaacgttttcatttaggttctgtatcacagattctcaagcaaacgaccgattgtgtttatt |
24291005 |
T |
 |
| Q |
102 |
ttctttgtagcactgcttgtttggtgggcattacaggcgtttttgctccacttcttgaggagacagtttt-cgaggcttttttatgatgtccctatctaa |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |||| |
|
|
| T |
24291004 |
ttcattgtagcactgcttgtttggtgggcatcacaggcgtttttgctccacttcttgaggagacagttttccgaggcttttttatgacgtccctaactaa |
24290905 |
T |
 |
| Q |
201 |
atggtattgattgtctct |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
24290904 |
atggtattgattgtctct |
24290887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University