View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3190_high_75 (Length: 211)
Name: NF3190_high_75
Description: NF3190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3190_high_75 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 12 - 180
Target Start/End: Original strand, 4968753 - 4968922
Alignment:
| Q |
12 |
agcagagagatgattgagagagagaaa-gaaatatatatcattctgacggtgtaacataacatcattcatccgacgattcaaataacttgtccatcgtga |
110 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
4968753 |
agcaaagagatgattgagagagagaaaagaaatatatatcattctgatggtgtaacataacatcatttatcggacgattcaaataacttgtccatcgtga |
4968852 |
T |
 |
| Q |
111 |
gagacttgcttcacttgcccaccctagcatccgcgccaagttcactttgttttgaaacataacttctttc |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4968853 |
gagacttgcttcacttgcccaccctagcatcggcgccaagttcactttgttttgaaacataacttctttc |
4968922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University