View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3190_high_76 (Length: 210)

Name: NF3190_high_76
Description: NF3190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3190_high_76
NF3190_high_76
[»] chr1 (1 HSPs)
chr1 (12-195)||(14442802-14442991)


Alignment Details
Target: chr1 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 12 - 195
Target Start/End: Complemental strand, 14442991 - 14442802
Alignment:
12 agcataggaatgaaaatacgccatatcgtaatcagtgcaaggagatcgattaggtagttgttgctgctgttgcggcggttgttcggtatcggaaacccta 111  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
14442991 agcataggaatgaaaatacgccatatcgtaatcagtgcaaggagatcgattaggtagttgttgctgctgttgcggcggttgttctgtatcggaaacccta 14442892  T
112 acaat------agaagtagaactggaagcgcgtgaacggcgagtaccacgacgggcacgatgagtttgcaccattcctgacggtggttgt 195  Q
    ||| |      ||||| ||||  ||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||    
14442891 acagtggaagaagaagaagaaacggaagcgcgtgaacggcgagtgccacgacgggcacggtgagtttgcaccattcctgacggtggttgt 14442802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University