View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3190_high_76 (Length: 210)
Name: NF3190_high_76
Description: NF3190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3190_high_76 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 12 - 195
Target Start/End: Complemental strand, 14442991 - 14442802
Alignment:
| Q |
12 |
agcataggaatgaaaatacgccatatcgtaatcagtgcaaggagatcgattaggtagttgttgctgctgttgcggcggttgttcggtatcggaaacccta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14442991 |
agcataggaatgaaaatacgccatatcgtaatcagtgcaaggagatcgattaggtagttgttgctgctgttgcggcggttgttctgtatcggaaacccta |
14442892 |
T |
 |
| Q |
112 |
acaat------agaagtagaactggaagcgcgtgaacggcgagtaccacgacgggcacgatgagtttgcaccattcctgacggtggttgt |
195 |
Q |
| |
|
||| | ||||| |||| ||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14442891 |
acagtggaagaagaagaagaaacggaagcgcgtgaacggcgagtgccacgacgggcacggtgagtttgcaccattcctgacggtggttgt |
14442802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University