View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3190_low_25 (Length: 379)
Name: NF3190_low_25
Description: NF3190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3190_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 9 - 366
Target Start/End: Complemental strand, 31935638 - 31935287
Alignment:
| Q |
9 |
gattatactatcacattttgtccttcttcttctccaaggtaaataaaacttttcactcaagaaaactaaaagcaaaacttttcacnnnnnnnnnnnnnnn |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31935638 |
gattatactatcacattttgtccttcttcttctccaaggtaaataaaacttttcgctcaagaaaactaaaagcaaaacttttcactttttttttg----- |
31935544 |
T |
 |
| Q |
109 |
naagggaaaagcaaaacttttcactctttaatcaaggttttaactcaatttcacccctatcaaaggttattggttaaacaagttgttaatgacacctttt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31935543 |
-aagggaaaagcaaaacttttcactctttaatcaaggttttaactcaatttcacccctatcaaaggttattggttaaacaagttgttaatgacatctttt |
31935445 |
T |
 |
| Q |
209 |
ggtataacataaatttgtcacaatcacgataaactatgtgattttacaaaagttagggatcgtatcttttacaaaatcacgatgttaaacatgcattaag |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31935444 |
ggtataacataaatttgtcacaatcacgataaattatgtgatttaacaaaaattagggattgtatcttttacaaaatcacgatgttaaacatgcattaag |
31935345 |
T |
 |
| Q |
309 |
tcgattttacaactatcaaaattcaaaaggtggtcgatgcagtcttaatggttgttat |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31935344 |
tcgattttacaactatcaaaattcaaaaggtggtcgatgcagtcttaatggttgttat |
31935287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University