View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3190_low_26 (Length: 377)
Name: NF3190_low_26
Description: NF3190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3190_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 18 - 359
Target Start/End: Complemental strand, 37218217 - 37217877
Alignment:
| Q |
18 |
atatgtggggtaataaatataacgaagagatgtttatctagcgttcaacaaatgattgtaaagaaacctctnnnnnnnttgaaaataaaattactcataa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37218217 |
atatgtggggtaataaatataacgaagagatgtttatctagcgttcaacaaatgattataaagaaacctctaaaaaaaatgaaaataaaattactcataa |
37218118 |
T |
 |
| Q |
118 |
tgttctaggatttgaatattccttcttagttcttattggaaactacggnnnnnnnntgcatttggattgtggcaggttttaagccattttgcaaggattt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37218117 |
tgttctaggatttgaatattccttcttagttcttattggaaactacggacaaaaa-tgcatttggattgtggcaggttttaagccattttgcgaggattt |
37218019 |
T |
 |
| Q |
218 |
taaccatcgcaaaatattttgagggagttttcaaaagtccctgcaacgaaacctcagcagtcagcatttgggttcgaatgtatatccagtaatgggagga |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37218018 |
taaccatcgcaaaatattttgagggagttttcaaaagtccctgcaacgaaacctcagcagtcagcatttgggttcgaatgtatatccagtaatgggagga |
37217919 |
T |
 |
| Q |
318 |
gcaattttgaggaaattcatgattaggcggagcggataggct |
359 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37217918 |
gcaattttgaggaaattcatgattaggcggagcggataggct |
37217877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University