View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3190_low_34 (Length: 325)
Name: NF3190_low_34
Description: NF3190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3190_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 21 - 133
Target Start/End: Complemental strand, 30016879 - 30016767
Alignment:
| Q |
21 |
attattgtataacatgtggataaaagtagtgcttacaaaaccatattatatgcatgtaagaagcacaagaatgtaagaaggaagatataaacaaaaaggg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30016879 |
attattgtataacatgtggataaaagtagtgcttacaaaaccatattatatgcatgtaagaagcacaagaatgtaagaaggaagatataaacaaaaaggg |
30016780 |
T |
 |
| Q |
121 |
attaatccaacct |
133 |
Q |
| |
|
||||||||||||| |
|
|
| T |
30016779 |
attaatccaacct |
30016767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 198 - 315
Target Start/End: Complemental strand, 30016702 - 30016586
Alignment:
| Q |
198 |
tcctattagaataaaataatatgtattataatttatatggtgcatgtcatagggtacgttactgttgaggagatgaaggaggataattaactatttgcat |
297 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30016702 |
tcctattagaataaa-taatatgtattataatttatatggtgcatgtcatagggtacgttactgttgaggagatgaaggaggataattaactatttgcat |
30016604 |
T |
 |
| Q |
298 |
tttttaattatgtctgtg |
315 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
30016603 |
tttttaattatgtgtgtg |
30016586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University