View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3190_low_42 (Length: 292)
Name: NF3190_low_42
Description: NF3190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3190_low_42 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 18 - 282
Target Start/End: Original strand, 56281891 - 56282160
Alignment:
| Q |
18 |
ggatgtaacccagcagctatttcctttggcagtgaagcaactgctacaacctacgtacgtacaaatccggtttacattattttcacttagtgatttaatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56281891 |
ggatgtaacccagcagctatttcctttggcagtgaagcaactgctacaacctacgtacgtacaaatccggtttacattattttcacttagtgatttaatt |
56281990 |
T |
|
| Q |
118 |
tgaaggagaaaaagaattattagt----actaactaacctcagtgccatcttccatggtttgacggcgctcatagacaatgaattctctattcctaaaga |
213 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56281991 |
tgaaggagaaaaagaattattagtattaactaactaaccacagtgccatcttccatggtttgacggcgctcatagacaatgaattctctattcctaaaga |
56282090 |
T |
|
| Q |
214 |
gaggcttagagttatctccaaacctaaggcgaattatgcttaggttgtcttcaatttc-tttatgtacct |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
56282091 |
gaggcttagagttatctccaaacctaaggcgaattatgcttaggttgtcttcaatttcttttatgtacct |
56282160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University